Possible enhancements for SMRTbell adapter handling in HiFi reads

[diegomics]

Hi devs, thanks for this tool.
I was wondering if 1) it can detect and remove internal adapters, 2) if it can discard an entire read if any adapter (internal or otherwise) is found, and 3) if the automatic adapter detection internal library contains the SMRTbell adapters (ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT, ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT)?
Context: due to the nature of SMRT sequencing technology, adapters do not have a specific, predictable location in HiFi reads. Additionally, the reads containing adapter sequences could be of generally lower quality compared to the rest of the reads.
Thanks!